Encomenda rápida

Text Size:AAA

Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse NGF Informações sobre o produto de clone de cDNA
Tamanho de cDNA:726bp
Descrição de cDNA:Full length Clone DNA of Mus musculus nerve growth factor, transcript variant B with C terminal Myc tag.
Sinónimo de gene:Ngfb, Ngf
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50385-ACG$225
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50385-ACR$225
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50385-CF$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50385-CH$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50385-CM$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50385-CY$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de expressão)MG50385-M$75
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50385-NF$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50385-NH$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50385-NM$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50385-NY$195
Ratazanao NGF/NGFB/beta-NGF transcript variant B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50385-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.
  • Size / Price
    Catálogo: MG50385-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.