Encomenda rápida

Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse NDNL2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:840bp
Descrição de cDNA:Full length Clone DNA of Mus musculus necdin-like 2 with N terminal His tag.
Sinónimo de gene:HCA4; Mageg1; mage-g1; AI642138; BB044375; 5730494G16Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51970-ACG$225
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51970-ACR$225
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51970-ANG$225
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51970-ANR$225
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51970-CF$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51970-CH$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51970-CM$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51970-CY$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51970-NF$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51970-NH$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51970-NM$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51970-NY$195
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51970-U$75
Ratazanao NDNL2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51970-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51970-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.