After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse NCF2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010877.4
Tamanho de cDNA:1578bp
Descrição de cDNA:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
Sinónimo de gene:NOXA2, Ncf-2, p67phox
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52449-ACG$245
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52449-ACR$245
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52449-ANG$245
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52449-ANR$245
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52449-CF$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52449-CH$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52449-CM$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52449-CY$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de expressão)MG52449-G$75
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52449-NF$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52449-NH$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52449-NM$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52449-NY$215
Ratazanao NCF2 / NCF-2 / P67phox clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52449-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

Referências
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Catálogo: MG52449-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"