Encomenda rápida

Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato MTMR7 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001040699.1
    Tamanho de cDNA:1983bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus myotubularin related protein 7.
    Sinónimo de gene:Mtmr7
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MTMR7 qPCR primers for gene expression analysis, MP202341 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52468-ACG$245
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52468-ACR$245
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52468-ANG$245
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52468-ANR$245
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52468-CF$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52468-CH$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52468-CM$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52468-CY$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52468-G$75
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52468-NF$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52468-NH$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52468-NM$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52468-NY$215
    Ratazanao MTMR7 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52468-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG52468-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"