Encomenda rápida

Ratazanao MT-ATP6 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato MTATP6 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:AF093677.1
    Tamanho de cDNA:681bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus ATP synthase 6, mitochondrial.
    Sinónimo de gene:ATP6
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with Mtatp6 qPCR primers for gene expression analysis, MP201097 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"