After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao GDF-8/Myostatin/MSTN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MSTN Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1131bp
Descrição de cDNA:Full length Clone DNA of Mus musculus myostatin with N terminal Flag tag.
Sinónimo de gene:Cmpt, Gdf8, MGC124261, MGC124262, MGC124263, Mstn
Local de restrição:KpnI + XbaI (6kb + 1.18kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse MSTN Gene Plasmid Map
Mouse MSTN natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao GDF-8/Myostatin/MSTN clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

GDF-8 / Myostatin / MSTN is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. GDF-8 / Myostatin / MSTN is highly expressed in skeletal muscle, and myostatin loss-of-function leads to doubling of skeletal muscle mass. Experiments in mice have improved that GDF-8 / Myostatin / MSTN is a key regulator of mesenchymal stem cell proliferation and differentiation, and mice lacking Myostatin encoding gene show decreased body fat and a generalized increase in bone density and strength. The increase in bone density is observed in most anatomical regions, including the limbs, spine, and jaw, and myostatin inhibitors have been observed to significantly increase bone formation. GDF-8 / Myostatin / MSTN is also expressed in the early phases of fracture healing, and GDF-8 / Myostatin / MSTN deficiency leads to increased fracture callus size and strength. Together, these data suggest that GDF-8 / Myostatin / MSTN has direct effects on the proliferation and differentiation of osteoprogenitor cells, and that GDF-8/Myostatin/MSTN antagonists and inhibitors are likely to enhance both muscle mass and bone strength.

  • Elkasrawy MN, et al. (2010) Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact. 10(1): 56-63.
  • Kambadur R, et al. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7 (9): 910-6.
  • McPherron AC, et al. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 387 (6628): 83-90.
  • Size / Price
    Catálogo: MG50441-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Mouse MSTN natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.