Encomenda rápida

Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato MPHOSPH6 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_026758.3
Tamanho de cDNA:486bp
Descrição de cDNA:Full length Clone DNA of Mus musculus M phase phosphoprotein 6 with N terminal His tag.
Sinónimo de gene:C86426, AA536809, 1110001M01Rik
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52816-ACG$225
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52816-ACR$225
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52816-ANG$225
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52816-ANR$225
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52816-CF$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52816-CH$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52816-CM$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52816-CY$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52816-G$75
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52816-NF$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52816-NH$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52816-NM$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52816-NY$195
Ratazanao MPHOSPH6 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52816-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52816-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"