MLF2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52007-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All MLF2 Reagents

CRO Services

Product recommended


All MLF2 Reagents

MLF2 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Mouse myeloid leukemia factor 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MLF2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

AI256856 cDNA ORF Clone, Mouse;AU018944 cDNA ORF Clone, Mouse;C77284 cDNA ORF Clone, Mouse

MLF2 Background Information

Full Name
myeloid leukemia factor 2

MLF2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Rhesus CG90686-G
MLF2 cDNA ORF Clone, Rhesus, untagged CG90686-UT
MLF2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90686-ACGLN
MLF2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90686-ACG
MLF2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90686-ANG
MLF2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90686-ACR
MLF2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90686-ANR
MLF2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90686-CF
MLF2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90686-NF
MLF2 cDNA ORF Clone, Rhesus, C-His tag CG90686-CH
MLF2 cDNA ORF Clone, Rhesus, N-His tag CG90686-NH
MLF2 cDNA ORF Clone, Rhesus, C-HA tag CG90686-CY
MLF2 cDNA ORF Clone, Rhesus, N-HA tag CG90686-NY
MLF2 cDNA ORF Clone, Rhesus, C-Myc tag CG90686-CM
MLF2 cDNA ORF Clone, Rhesus, N-Myc tag CG90686-NM

MLF2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90702-G
MLF2 cDNA ORF Clone, Cynomolgus, untagged CG90702-UT
MLF2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90702-ACG
MLF2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90702-ACGLN
MLF2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90702-ANG
MLF2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90702-ACR
MLF2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90702-ANR
MLF2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90702-CF
MLF2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90702-NF
MLF2 cDNA ORF Clone, Cynomolgus, C-His tag CG90702-CH
MLF2 cDNA ORF Clone, Cynomolgus, N-His tag CG90702-NH
MLF2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90702-CY
MLF2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90702-NY
MLF2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90702-CM
MLF2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90702-NM

MLF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Mouse MG52007-U
MLF2 cDNA ORF Clone, Mouse, untagged MG52007-UT
MLF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52007-ACG
MLF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52007-ACGLN
MLF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52007-ANG
MLF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52007-ACR
MLF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52007-ANR
MLF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52007-CF
MLF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52007-NF
MLF2 cDNA ORF Clone, Mouse, C-His tag MG52007-CH
MLF2 cDNA ORF Clone, Mouse, N-His tag MG52007-NH
MLF2 cDNA ORF Clone, Mouse, C-HA tag MG52007-CY
MLF2 cDNA ORF Clone, Mouse, N-HA tag MG52007-NY
MLF2 cDNA ORF Clone, Mouse, C-Myc tag MG52007-CM
MLF2 qPCR Primer Pairs, Mouse MP201880

MLF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Human HG16686-U
MLF2 cDNA ORF Clone, Human, untagged HG16686-UT
MLF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16686-ACGLN
MLF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16686-ACG
MLF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16686-ANG
MLF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16686-ACR
MLF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16686-ANR
MLF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16686-CF
MLF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16686-NF
MLF2 cDNA ORF Clone, Human, C-His tag HG16686-CH
MLF2 cDNA ORF Clone, Human, N-His tag HG16686-NH
MLF2 cDNA ORF Clone, Human, C-HA tag HG16686-CY
MLF2 cDNA ORF Clone, Human, N-HA tag HG16686-NY
MLF2 cDNA ORF Clone, Human, C-Myc tag HG16686-CM
MLF2 cDNA ORF Clone, Human, N-Myc tag HG16686-NM
info info
添加购物车成功! 添加购物车失败!