After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao MESDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MESDC2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_023403.2
Tamanho de cDNA:674bp
Descrição de cDNA:Full length Clone DNA of Mus musculus mesoderm development candidate 2 with N terminal Myc tag.
Sinónimo de gene:AW537813, MGC25959, mKIAA0081, 2210015O11Rik, Mesdc2
Espécie:Mouse
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fundo

LDLR chaperone MESD, also known as Mesoderm development protein, Mesoderm development candidate 2, Renal carcinoma antigen NY-REN-61 and MESDC2, is a member of the MESD family. MESDC2 is a chaperone specifically assisting the folding of beta-propeller/EGF modules within the family of low-density lipoprotein receptors (LDLRs). The LDLR maturation activity resides in the N- and C-terminal unstructured regions. MESDC2 acts as a modulator of the Wnt pathway, since some LDLRs are coreceptors for the canonical Wnt pathway. MESDC2 is essential for specification of embryonic polarity and mesoderm induction.

Referências
  • Scanlan M.J. et al., 1999, Int. J. Cancer 83:456-464.
  • Veltman,IM. et al.,2005, Hum Mol Genet  14 (14):1955-63.
  • Koduri V. et al., 2007, Biochemistry 46:6570-7.
  • Size / Price
    Catálogo: MG50200-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"