Encomenda rápida

Text Size:AAA

Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MED10 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:408 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus mediator complex subunit 10
Sinónimo de gene:AA959813,AI385605,C78613,D13Wsu50e
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52279-ACG$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52279-ACR$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52279-ANG$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52279-ANR$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52279-CF$75
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52279-CH$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52279-CM$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52279-CY$195
Mouse MED10 Gene cDNA clone plasmidMG52279-G$75
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52279-NF$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52279-NH$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52279-NM$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52279-NY$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52279-U$75
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52279-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52279-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.