Encomenda rápida

Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato MED10 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_138596.2
Tamanho de cDNA:408 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus mediator complex subunit 10
Sinónimo de gene:AA959813,AI385605,C78613,D13Wsu50e
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MED10 qPCR primers for gene expression analysis, MP202152 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52279-ACG$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52279-ACR$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52279-ANG$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52279-ANR$225
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52279-CF$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52279-CH$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52279-CM$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52279-CY$195
Mouse MED10 Gene cDNA clone plasmidMG52279-G$75
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52279-NF$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52279-NH$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52279-NM$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52279-NY$195
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52279-U$75
Ratazanao MED10 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52279-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52279-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"