After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao MARCO clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MARCO Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010766.2
Tamanho de cDNA:1557bp
Descrição de cDNA:Full length Clone DNA of Mus musculus macrophage receptor with collagenous structure.
Sinónimo de gene:Ly112; Scara2; AI323439; Marco
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

Macrophage receptor MARCO, also known as Macrophage receptor with collagenous structure and Marco, is a single-pass type I I membrane protein. MARCO is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. It is expressed in subpopulations of macrophages in the spleen and the medullary cord of lymph nodes. Although it is expressed on subsets of macrophages, it can be upregulated on other macrophages after bacterial infection. The strategic position of MARCO-expressing cells in lymphoid organs suggests an important role for this bacteria-binding molecule in removal of pathogens. MARCO has a short N-terminal cytoplasmic domain, a transmembrane domain, and a large extracellular part composed of a 75-residue long spacer domain, a 270-residue collagenous domain, and a 99-residue long scavenger receptor cysteine-rich (SRCR) domain. It is possible that cooperation between the SRCR domain and the collagenous domain is needed for high-affinity bacterial binding, or that the SRCR domain has to be in a trimeric form to effectively bind to bacteria

Referências
  • Kraal, G. et al., 2000, Microbes Infect . 2 (3): 313-6.
  • Sankala, M., 2002, J Biol Chem. 277 (36): 33378-85.
  • Arredouani, MS., 2004, Cell Mol Biol. 50 Online Pub : OL657-65.
  • Thakur, SA., 2009, Toxicol Sci. 107 (1): 238-46.
  • Size / Price
    Catálogo: MG50283-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"