Encomenda rápida

Text Size:AAA

Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MAPK13 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1101bp
Descrição de cDNA:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 13 with C terminal Flag tag.
Sinónimo de gene:SAPK4, Serk4, Mapk13
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51020-ACG$225
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51020-ACR$225
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51020-ANG$225
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51020-ANR$225
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51020-CF$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51020-CH$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51020-CM$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51020-CY$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51020-G$75
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51020-NF$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51020-NH$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51020-NM$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51020-NY$195
Ratazanao p38 delta/MAPK13 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51020-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.

  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • Size / Price
    Catálogo: MG51020-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.