After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MAPK10 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1269bp
Descrição de cDNA:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 10 with C terminal His tag.
Sinónimo de gene:JNK3, Serk2, JNK3B1, JNK3B2, p493F12, p54bSAPK, SAPK(beta), C230008H04Rik, Mapk10
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51077-ACG$225
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51077-ACR$225
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51077-ANG$225
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51077-ANR$225
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51077-CF$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51077-CH$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51077-CM$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51077-CY$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51077-G$75
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51077-NF$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51077-NH$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51077-NM$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51077-NY$195
Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51077-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51077-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.