Encomenda rápida

Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato MAPK10 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_009158.2
    Tamanho de cDNA:1269bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 10 with C terminal His tag.
    Sinónimo de gene:JNK3, Serk2, JNK3B1, JNK3B2, p493F12, p54bSAPK, SAPK(beta), C230008H04Rik, Mapk10
    Espécie:Mouse
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MAPK10 qPCR primers for gene expression analysis, MP201035 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51077-ACG$225
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51077-ACR$225
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51077-ANG$225
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51077-ANR$225
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51077-CF$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51077-CH$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51077-CM$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51077-CY$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51077-G$75
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51077-NF$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51077-NH$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51077-NM$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51077-NY$195
    Ratazanao MAPK10/JNK3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51077-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51077-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"