After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MAP3K8 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007746.2
Tamanho de cDNA:1443 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus mitogen-activated protein kinase kinase kinase 8 with N terminal Flag tag.
Sinónimo de gene:c-COT,Cot,Cot/Tpl2,Est,Estf,Tpl-2,Tpl2
Espécie:Mouse
Vetor:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-mMAP3K8
Local de restrição:KpnI + XbaI(6kb+1.44kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50438-ACG$225
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50438-ACR$225
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50438-ANG$225
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50438-ANR$225
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50438-CF$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50438-CH$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50438-CM$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50438-CY$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50438-M$75
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50438-NF$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50438-NH$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50438-NM$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50438-NY$195
Ratazanao TPL2/MAP3K8/MEKK8 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50438-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

Referências
  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    Catálogo: MG50438-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
    • Human aFGF/FGF1 Gene Plasmid Map 5637
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"