Encomenda rápida

Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato MAGED1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2328bp
Descrição de cDNA:Full length Clone DNA of Mus musculus melanoma antigen, family D, 1 with N terminal His tag.
Sinónimo de gene:NRAGE; Dlixin; Dlxin1; Dlxin-1; MAGE-D1; mFLJ00163; DXBwg1492e; 2810433C11Rik; 5430405L04Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
( We provide with MAGED1 qPCR primers for gene expression analysis, MP201269 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51399-ACG$245
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51399-ACR$245
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51399-ANG$245
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51399-ANR$245
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51399-CF$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51399-CH$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51399-CM$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51399-CY$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51399-NF$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51399-NH$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51399-NM$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51399-NY$215
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51399-U$75
Ratazanao MAGED1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51399-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51399-NH
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.