After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse LTA4H Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_008517.2
Tamanho de cDNA:1836bp
Descrição de cDNA:Full length Clone DNA of Mus musculus leukotriene A4 hydrolase.
Sinónimo de gene:Lta4h
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50268-ACG$245
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50268-ACR$245
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50268-ANG$245
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50268-ANR$245
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50268-CF$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50268-CH$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50268-CM$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50268-CY$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de expressão)MG50268-M$75
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50268-NF$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50268-NH$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50268-NM$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50268-NY$215
Ratazanao Leukotriene A4 Hydrolase/LTA4H clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50268-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Mouse leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

Referências
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • Size / Price
    Catálogo: MG50268-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"