Encomenda rápida

Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato LRPAP1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_013587.2
    Tamanho de cDNA:1083bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus low density lipoprotein receptor-related protein associated protein 1.
    Sinónimo de gene:RAP, HBP44, C77774, AA617339, AI790446, AU042172, Lrpap1
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LRPAP1 qPCR primers for gene expression analysis, MP200305 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50281-ACG$225
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50281-ACR$225
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50281-ANG$225
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50281-ANR$225
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50281-CF$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50281-CH$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50281-CM$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50281-CY$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de expressão)MG50281-M$75
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50281-NF$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50281-NH$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50281-NM$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50281-NY$195
    Ratazanao LRPAP1/A2MRAP clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50281-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Receptor-associated protein (RAP) is a molecular chaperone for low density lipoprotein receptor-related protein (LRP), which plays a key role in cholesterol metabolism. The lipoprotein receptor-related protein (LRP) is an endocytic receptor for several ligands, such as alpha2-macroglobulin (alpha2 M) and apolipoprotein E. LRP is involved in the clearance of lipids from the bloodstream and is expressed in the atherosclerotic plaque. The LRP-associated protein (LRPAP in humans, RAP in mice) acts as a chaperone protein, stabilizing the nascent LRP peptide in the endoplasmic reticulum and Golgi complex. Alpha-2-macroglobulin receptor-associated protein, also known as low density lipoprotein receptor-related protein-associated protein 1, RAP and LRPAP1, is a 39 kDa protein and a member of the alpha-2-MRAP family. It is a receptor antagonist that interacts with several members of the low density lipoprotein (LDL) receptor gene family. Upon binding to these receptors, LRPAP1 inhibits all ligand interactions with the receptors. LRPAP1 is present on cell surface forming a complex with the alpha-2-macroglobulin receptor heavy and light chains. It binds with LRP1B and the binding is followed by internalization and degradation. LRPAP1 interacts with LRP1/alpha-2-macroglobulin receptor and LRP2 (previously called glycoprotein 330), and may be involved in the pathogenesis of membrane glomerular nephritis. LRPAP1 together with LRP2 forms the Heymann nephritis antigenic complex. LRP2 is expressed in epithelial cells of the thyroid, where it can serve as a receptor for the protein thyroglobulin. Intron 5 insertion/deletion polymorphism of RAP gene (LRPAP1) has been implicated in other diseases sharing etiology with gallstone disease (GSD). The LRPAP1 insertion/deletion polymorphism influences cholesterol homeostasis and may confer risk for gallstone disease and gallbladder carcinoma (GBC) incidence usually parallels with the prevalence of cholelithiosis. The genetic variations at the LRPAP1 locus may modulate Alzheimer disease (AD) phenotype beyond risk for disease. In addition, the variation at the LRPAP1 gene could contribute to the risk of developing an early episode of myocardial infarction (MI).

    Referências
  • Gonzlez P, et al. (2002) Variation in the lipoprotein receptor-related protein, alpha2-macroglobulin and lipoprotein receptor-associated protein genes in relation to plasma lipid levels and risk of early myocardial infarction. Coron Artery Dis. 13(5): 251-4.
  • Schutte DL, et al. (2003) A LRPAP1 intronic insertion/deletion polymorphism and phenotypic variability in Alzheimer disease. Res Theory Nurs Pract. 17(4): 301-19?
  • Pandey SN, et al. (2006) Lipoprotein receptor associated protein (LRPAP1) insertion/deletion polymorphism: association with gallbladder cancer susceptibility. Int J Gastrointest Cancer. 37(4): 124-8.
  • Dixit M, et al. (2006) Association of low density lipoprotein receptor related protein-associated protein (LRPAP1) gene insertion/deletion polymorphism with gallstone disease.J Gastroenterol Hepatol. 21(5): 847-9.
  • Size / Price
    Catálogo: MG50281-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"