Encomenda rápida

Text Size:AAA

Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse LMNA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1725bp
Descrição de cDNA:Full length Clone DNA of Mus musculus lamin A with C terminal His tag.
Sinónimo de gene:Dhe
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51713-ACG$245
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51713-ACR$245
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51713-ANG$245
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51713-ANR$245
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51713-CF$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51713-CH$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51713-CM$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51713-CY$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de expressão)MG51713-G$75
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51713-NF$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51713-NH$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51713-NM$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51713-NY$215
Ratazanao LMNA/lamins A clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51713-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51713-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.