After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse KLHL36 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1842bp
Descrição de cDNA:Full length Clone DNA of Mus musculus kelch-like 36 with N terminal His tag.
Sinónimo de gene:Klhl36
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51973-ACG$245
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51973-ACR$245
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51973-ANG$245
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51973-ANR$245
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51973-CF$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51973-CH$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51973-CM$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51973-CY$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51973-G$75
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51973-NF$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51973-NH$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51973-NM$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51973-NY$215
Ratazanao C16orf44/KLHL36 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51973-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51973-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.