After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse KLHDC2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_027117.3
Tamanho de cDNA:1221bp
Descrição de cDNA:Full length Clone DNA of Mus musculus kelch domain containing 2 with N terminal His tag.
Sinónimo de gene:LCP, HCLP-1, D12Ertd522e, 2310022K15Rik
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51979-ACG$225
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51979-ACR$225
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51979-ANG$225
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51979-ANR$225
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51979-CF$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51979-CH$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51979-CM$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51979-CY$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51979-G$75
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51979-NF$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51979-NH$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51979-NM$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51979-NY$195
Ratazanao KLHDC2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51979-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51979-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"