Encomenda rápida

Ratazanao LSD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato KDM1A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_133872.2
Tamanho de cDNA:2562bp
Descrição de cDNA:Full length Clone DNA of Mus musculus lysine (K)-specific demethylase 1A with N terminal His tag.
Sinónimo de gene:Aof2, Kdm1, Lsd1, AA408884, mKIAA0601, D4Ertd478e, 1810043O07Rik
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with KDM1A qPCR primers for gene expression analysis, MP201858 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao LSD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name
Fundo

LSD1 belongs to the flavin monoamine oxidase family. It contains 1 SWIRM domain and is a component of a RCOR/GFI/LSD1/HDAC complex. LSD1 interacts directly with GFI1 and GFI1B. LSD1 speficially removes histone H3K4me2 to H3K4me1 or H3K4me0 through a FAD-dependent oxidative reaction. When forming a complex with androgen receptor (and possibly other nuclear hormone receptors), LSD1 changes its substrates to H3K9me2. Thus LSD1 is considered to act as a coactivator or a corepressor. It may play a role in the repression of neuronal genes. Alone, LSD1 is unable to demethylate H3 'Lys-4' on nucleosomes and requires the presence of RCOR1/CoREST to achieve such activity.

Referências
  • Kusaba M, et al. (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell. 19(4):1362-75.
  • Pazour GJ, et al. (2005) Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170(1):103-13.
  • Merchant SS, et al. (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 318(5848):245-50.
  • Size / Price
    Catálogo: MG51985-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"