Encomenda rápida

Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse JTB Informações sobre o produto de clone de cDNA
Tamanho de cDNA:441bp
Descrição de cDNA:Full length Clone DNA of Mus musculus jumping translocation breakpoint with C terminal Flag tag.
Sinónimo de gene:Gm622
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52774-ACG$225
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52774-ACR$225
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52774-CF$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52774-CH$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52774-CM$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52774-CY$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de expressão)MG52774-G$75
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52774-NF$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52774-NH$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52774-NM$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52774-NY$195
Ratazanao jumping translocation breakpoint / JTB clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52774-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catálogo: MG52774-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.