After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse JAM2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_023844.4
Tamanho de cDNA:897bp
Descrição de cDNA:Full length Clone DNA of Mus musculus junction adhesion molecule 2 with N terminal Flag tag.
Sinónimo de gene:JAM-2, JAM-B, Jcam2, VE-JAM, AU016127, 1110002N23Rik, 2410030G21Rik, 2410167M24Rik, Jam2
Espécie:Mouse
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50464-ACG$225
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50464-ACR$225
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50464-CF$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50464-CH$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50464-CM$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50464-CY$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de expressão)MG50464-M$75
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50464-NF$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50464-NH$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50464-NM$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50464-NY$195
Ratazanao Junctional Adhesion Molecule B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50464-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

Referências
  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Catálogo: MG50464-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"