Encomenda rápida

Text Size:AAA

Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ITGA5 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:3162bp
Descrição de cDNA:Full length Clone DNA of Mus musculus integrin alpha 5 (fibronectin receptor alpha) with N terminal His tag.
Sinónimo de gene:Fnra, Cd49e, Itga5
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50133-ACG$325
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50133-ACR$325
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50133-CF$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50133-CH$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50133-CM$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50133-CY$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50133-M$75
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50133-NF$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50133-NH$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50133-NM$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50133-NY$295
Ratazanao Integrin alpha 5/CD49e/ITGA5 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50133-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG50133-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.