Encomenda rápida

Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato ITGB2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_008404.4
Tamanho de cDNA:2313bp
Descrição de cDNA:Full length Clone DNA of Mus musculus integrin beta 2 with C terminal Myc tag.
Sinónimo de gene:2E6, LAD, Cd18, Lfa1, MF17, LCAMB, AI528527, Itgb2
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB2 qPCR primers for gene expression analysis, MP200380 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50359-ACG$245
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50359-ACR$245
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50359-CF$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50359-CH$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50359-CM$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50359-CY$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50359-M$75
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50359-NF$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50359-NH$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50359-NM$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50359-NY$215
Ratazanao CD18/Integrin beta 2/ITGB2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50359-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Integrins form a family of heterodimeric transmembrane receptors that regulate cell–adhesion and cell-extracellular matrix interactions. Lymphocyte function-associated antigen 1 (LFA-1, αLβ2) is a leukocyte specific integrin that mediates firm arrest of leukocytes on the endothelium during migration and establishes cell-cell contacts such as the immunological synapse between DCs and T cells. At the molecular level, transient modifications of adhesion are accomplished by conformational changes of LFA-1 from a bent down inactive to an upright active conformation with an open headpiece, leading to low- and high-affinity for its major ligand ICAM-1 respectively.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referências
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
  • Size / Price
    Catálogo: MG50359-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"