Encomenda rápida

Text Size:AAA

Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse INSR Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010568.2
Tamanho de cDNA:4119bp
Descrição de cDNA:Full length Clone DNA of Mus musculus insulin receptor with C terminal His tag.
Sinónimo de gene:IR, IR-A, IR-B, CD220, 4932439J01Rik, D630014A15Rik, Insr
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51062-ACG$375
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51062-ACR$375
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51062-CF$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51062-CH$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51062-CM$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51062-CY$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51062-G$75
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51062-NF$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51062-NH$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51062-NM$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51062-NY$345
Ratazanao Insulin Receptor/INSR/CD220 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51062-UT$345
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Size / Price
Catálogo: MG51062-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"