Encomenda rápida

Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato IL7 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:465bp
Descrição de cDNA:Full length Clone DNA of Mus musculus interleukin 7 with N terminal Myc tag.
Sinónimo de gene:Il-7, hlb368, MGC129342, A630026I06Rik
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
( We provide with IL7 qPCR primers for gene expression analysis, MP200244 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50217-ACG$225
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50217-ACR$225
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50217-CF$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50217-CH$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50217-CM$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50217-CY$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50217-M$75
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50217-M-N$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50217-NF$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50217-NH$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50217-NM$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50217-NY$195
Ratazanao IL7/IL-7/Interleukin-7 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50217-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • Size / Price
    Catálogo: MG50217-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.