Encomenda rápida

Text Size:AAA

Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse IL6ST Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2754bp
Descrição de cDNA:Full length Clone DNA of Mus musculus interleukin 6 signal transducer with N terminal His tag.
Sinónimo de gene:CD130, gp130, AA389424, BB405851, D13Ertd699e, 5133400A03Rik, Il6st
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50135-ACG$325
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50135-ACR$325
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50135-CF$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50135-CH$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50135-CM$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50135-CY$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50135-M$75
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50135-M-Y$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50135-NF$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50135-NH$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50135-NM$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50135-NY$295
Ratazanao IL6ST/gp130/CD130 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50135-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name

Glycoprotein 130 (also known as gp130, IL6ST, IL6-beta or CD130) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD130/gp130 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD130/gp130 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD130/gp130 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp130 for initiating signal transmission. CD130/gp130 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD130/gp130 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.

  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
  • Size / Price
    Catálogo: MG50135-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.