After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse IL5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010558.1
Tamanho de cDNA:402bp
Descrição de cDNA:Full length Clone DNA of Mus musculus interleukin 5 with C terminal His tag.
Sinónimo de gene:IL-5
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51068-ACG$225
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51068-ACR$225
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51068-CF$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51068-CH$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51068-CM$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51068-CY$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51068-G$75
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51068-NF$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51068-NH$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51068-NM$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51068-NY$195
Ratazanao IL-5/IL5 / Interleukin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51068-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

Referências
  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"