Encomenda rápida

Ratazanao IL18BP / IL18BPa clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse IL18BP Informações sobre o produto de clone de cDNA
Tamanho de cDNA:582bp
Descrição de cDNA:Full length Clone DNA of Mus musculus Interleukin 18 binding protein with N terminal Myc tag.
Sinónimo de gene:MC54L, Igifbp, IL-18BP
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao IL18BP / IL18BPa clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

Interleukin-18-binding protein (IL-18BP) is a constitutively expressed and secreted protein. IL-18BP is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. The adjacently located family members IL18 Receptor 1 (IL18R1) and IL18 receptor accessory protein (IL18RAP) may also be important in the development of asthma and atopy. IL-18 binding protein (IL-18BP) was only moderately elevated, resulting in a high level of biologically active free IL-18 in HPS. A severe IL-18/IL-18BP imbalance results in Th-1 lymphocyte and macrophage activation, which escapes control by NK-cell cytotoxicity and may allow for secondary HPS in patients with underlying diseases.

  • Novick D, et al.. (2001) A novel IL-18BP ELISA shows elevated serum IL-18BP in sepsis and extensive decrease of free IL-18. Cytokine. 14(6): 334-42.
  • Mazodier K, et al.. (2005) Severe imbalance of IL-18/IL-18BP in patients with secondary hemophagocytic syndrome. Blood. 106(10): 3483-9.
  • Akira S. (2000) The role of IL-18 in innate immunity. Curr Opin Immunol. 12(1): 59-63.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.