IL-17D/IL17D cDNA ORF Clone, Mouse, N-His tag

Cat: MG50108-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IL-17D/IL17D Reagents

CRO Services

Product recommended


All IL-17D/IL17D Reagents

IL-17D/IL17D cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Mouse interleukin 17 D with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-17D/IL17D cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI462269 cDNA ORF Clone, Mouse;IL-17D cDNA ORF Clone, Mouse;Il27a cDNA ORF Clone, Mouse

IL-17D/IL17D Background Information

Full Name
interleukin 17D

IL-17D/IL17D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL-17D/IL17D cDNA ORF Clone in Cloning Vector, Mouse MG50108-M
IL-17D/IL17D cDNA ORF Clone, Mouse, untagged MG50108-UT
IL-17D/IL17D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50108-ACG
IL-17D/IL17D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50108-ACGLN
IL-17D/IL17D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50108-ACR
IL-17D/IL17D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50108-CF
IL-17D/IL17D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50108-NF
IL-17D/IL17D cDNA ORF Clone, Mouse, C-His tag MG50108-CH
IL-17D/IL17D cDNA ORF Clone, Mouse, C-HA tag MG50108-CY
IL-17D/IL17D cDNA ORF Clone, Mouse, N-HA tag MG50108-NY
IL-17D/IL17D cDNA ORF Clone, Mouse, C-Myc tag MG50108-CM
IL-17D/IL17D cDNA ORF Clone, Mouse, N-Myc tag MG50108-NM
IL-17D/IL17D qPCR Primer Pairs, Mouse MP200138

IL-17D/IL17D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL-17D/IL17D cDNA ORF Clone in Cloning Vector, Human HG16051-G
IL-17D/IL17D cDNA ORF Clone, Human, untagged HG16051-UT
IL-17D/IL17D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16051-ACGLN
IL-17D/IL17D cDNA ORF Clone, Human, C-GFPSpark® tag HG16051-ACG
IL-17D/IL17D cDNA ORF Clone, Human, C-OFPSpark® tag HG16051-ACR
IL-17D/IL17D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16051-CF
IL-17D/IL17D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16051-NF
IL-17D/IL17D cDNA ORF Clone, Human, C-His tag HG16051-CH
IL-17D/IL17D cDNA ORF Clone, Human, N-His tag HG16051-NH
IL-17D/IL17D cDNA ORF Clone, Human, C-HA tag HG16051-CY
IL-17D/IL17D cDNA ORF Clone, Human, N-HA tag HG16051-NY
IL-17D/IL17D cDNA ORF Clone, Human, C-Myc tag HG16051-CM
IL-17D/IL17D cDNA ORF Clone, Human, N-Myc tag HG16051-NM
info info
添加购物车成功! 添加购物车失败!