Encomenda rápida

Ratazanao IL17A/IL-17A/IL17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato IL17A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:489 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus interleukin 17A with N terminal Flag tag.
Sinónimo de gene:Il17, Ctla8, Ctla-8
Local de restrição:KpnI + XbaI (6kb + 0.49kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
( We provide with IL17A qPCR primers for gene expression analysis, MP201021 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Rato IL17A Gene Plasmid Map
Mouse IL17A natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao IL17A/IL-17A/IL17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Catálogo: MG51065-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    • Mouse IL17A natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.