Encomenda rápida

Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato IL15 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_008357.1
Tamanho de cDNA:489bp
Descrição de cDNA:Full length Clone DNA of Mus musculus interleukin 15 with N terminal HA tag.
Sinónimo de gene:AI503618, Il15
Espécie:Mouse
Vetor:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-mIL15
Local de restrição:KpnI + XbaI (6kb + 0.49kb)
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL15 qPCR primers for gene expression analysis, MP200121 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Rato IL15 Gene Plasmid Map
Mouse IL15 ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50091-ACG$225
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50091-ACR$225
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50091-CF$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50091-CH$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50091-CM$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50091-CY$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50091-M$75
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50091-NF$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50091-NH$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50091-NM$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50091-NY$195
Ratazanao IL15/IL-15/Interleukin 15 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50091-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The protein encoded by IL15 gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referências
  • Mongini PKA, Gupta R, Boyle E, et al. TLR-9 and IL-15 synergy promotes the in vitro clonal expansion of chronic lymphocytic leukemia B cells. Journal of immunology (Baltimore, Md : 1950). 2015;195(3):901-923.
  • Size / Price
    Catálogo: MG50091-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    Imagens
    • Mouse IL15 ORF mammalian expression plasmid, N-HA tag
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"