Encomenda rápida

Ratazanao IGFBP6 / IBP6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse IGFBP6 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:717bp
Descrição de cDNA:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 6 with C terminal His tag.
Sinónimo de gene:IGFBP-6, Igfbp6
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Insulin-like growth factor binding protein 6 (IGFBP6) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. IGFBP6 is directly downregulated by the beta-catenin/TCF complex in desmoid tumors, and imply a role for the IGF axis in the proliferation of desmoid tumors. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

  • Denys H, et al. (2004) Identification of IGFBP-6 as a significantly downregulated gene by beta-catenin in desmoid tumors. Oncogene. 23(3): 654-64.
  • Bach LA. Insulin-like growth factor binding protein-6: the "forgotten" binding protein? Horm Metab Res. 31(2-3): 226-34.
  • Bach LA. IGFBP-6 five years on; not so 'forgotten'? Growth Horm IGF Res. 15(3): 185-92.
  • Size / Price
    Catálogo: MG50460-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.