After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao IFNAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse IFNAR1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010508.2
Tamanho de cDNA:1773bp
Descrição de cDNA:Full length Clone DNA of Mus musculus interferon (alpha and beta) receptor 1 with C terminal His tag.
Sinónimo de gene:Ifar, Ifrc, CD118, Ifnar, Infar, Ifnar1
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fundo

Interferon-alpha/beta receptor alpha chain (IFNAR1) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. Tyk2 slows down IFNAR1 degradation and that this is due, at least in part, to inhibition of IFNAR1 endocytosis. Mutant versions of IFNAR1, in which Tyr466 is changed to phenylalanine, can act in a dominant negative manner to inhibit phosphorylation of STAT2. These observations are consistent with a model in which IFNAR1 mediates the interaction between JAK kinases and the STAT transcription factors.

Referências
  • Yan H, et al. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15(5): 1064-74.
  • Richter MF, et al. (1998) Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J Biol Chem. 273(38): 24723-9.
  • Abramovich C, et al. (1997) A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J. 16(2): 260-6.
  • Size / Price
    Catálogo: MG50469-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"