Encomenda rápida

Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato HSPA8 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_031165
    Tamanho de cDNA:1941bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus heat shock protein 8 with C terminal HA tag.
    Sinónimo de gene:Hsc70; Hsc71; Hsc73; Hsp73; Hspa10; 2410008N15Rik
    Espécie:Mouse
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSPA8 qPCR primers for gene expression analysis, MP201075 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51191-ACG$245
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51191-ACR$245
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51191-ANG$245
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51191-ANR$245
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51191-CF$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51191-CH$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51191-CM$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51191-CY$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51191-G$115
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51191-NF$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51191-NH$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51191-NM$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51191-NY$215
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51191-U$75
    Ratazanao HSPA8/HSC70 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51191-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.

    Referências
  • Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.
  • Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.
  • Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.
  • Size / Price
    Catálogo: MG51191-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"