Encomenda rápida

Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato HN1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_008258.1
    Tamanho de cDNA:465bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus hematological and neurological expressed sequence 1.
    Sinónimo de gene:RP23-392H19.9, Hn1
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HN1 qPCR primers for gene expression analysis, MP201236 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51359-ACG$225
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51359-ACR$225
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51359-ANG$225
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51359-ANR$225
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51359-CF$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51359-CH$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51359-CM$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51359-CY$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51359-NF$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51359-NH$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51359-NM$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51359-NY$195
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51359-U$75
    Ratazanao HN-1 / ARM2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51359-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51359-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"