After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse HIST3H2A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_178218.3
Tamanho de cDNA:393bp
Descrição de cDNA:Full length Clone DNA of Mus musculus histone cluster 3, H2a with C terminal Flag tag.
Sinónimo de gene:Hist3h2a
Espécie:Mouse
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51011-ACG$225
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51011-ACR$225
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51011-ANG$225
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51011-ANR$225
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51011-CF$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51011-CH$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51011-CM$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51011-CY$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de expressão)MG51011-G$75
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51011-NF$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51011-NH$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51011-NM$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51011-NY$195
Ratazanao HIST3H2A clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51011-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

Referências
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.
  • Size / Price
    Catálogo: MG51011-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"