After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse HDDC3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC038310.1
Tamanho de cDNA:540bp
Descrição de cDNA:Full length Clone DNA of Mus musculus HD domain containing 3.
Sinónimo de gene:MESH1, C86475, 1110033O09Rik
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51334-ACG$225
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51334-ACR$225
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51334-ANG$225
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51334-ANR$225
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51334-CF$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51334-CH$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51334-CM$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51334-CY$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51334-NF$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51334-NH$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51334-NM$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51334-NY$195
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51334-U$75
Ratazanao HDDC3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51334-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"