After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse HDAC8 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_027382.3
Tamanho de cDNA:1134bp
Descrição de cDNA:Full length Clone DNA of Mus musculus histone deacetylase 8.
Sinónimo de gene:2610007D20Rik
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50273-ACG$225
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50273-ACR$225
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50273-ANG$225
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50273-ANR$225
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50273-CF$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50273-CH$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50273-CM$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50273-CY$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50273-M$75
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50273-NF$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50273-NH$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50273-NM$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50273-NY$195
Ratazanao HDAC8 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50273-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

Referências
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    Catálogo: MG50273-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"