Encomenda rápida

Text Size:AAA

Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse H1F0 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:585bp
Descrição de cDNA:Full length Clone DNA of Mus musculus H1 histone family, member 0 with C terminal Flag tag.
Sinónimo de gene:H1fv, H1(0), MGC19309, MGC98218, MGC117919, D130017D06Rik, H1f0
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51008-ACG$225
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51008-ACR$225
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51008-ANG$225
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51008-ANR$225
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51008-CF$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51008-CH$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51008-CM$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51008-CY$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51008-G$75
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51008-NF$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51008-NH$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51008-NM$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51008-NY$195
Ratazanao H1F0/Histone H1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51008-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

H1 histone family, member 0 (H1F0) is a member of the H1 histone family of nuclear proteins which are a component of chromatin in eukaryotic cells. It's involved in maintaining the structure of chromatin by packing the "beads on a string" sub-structure into a high order structure. The lysine-rich H1 histone family in mammals includes eleven members. In higher eukaryotes all H1 variants have the same general structure, consisting of a central conserved globular domain and less conserved N-terminal and C-terminal tails. These tails are moderately conserved among species, but differ among variants, suggesting a specific function for each H1 variant. Studies on the role of particular subtypes at specific developmental stages in lower eukaryotes, but also in vertebrates suggest that specific subtypes of H1 participate in particular systems of gene regulation. 

  • Ramakrishnan V, et al. (1993) Crystal structure of globular domain of histone H5 and its implications for nucleosome binding. Nature. 362 (6417): 219-23.
  • Happel N, et al. (2009) Histone H1 and its isoforms: contribution to chromatin structure and function. Gene. 431 (1-2): 1-12.
  • Izzo A, et al. (2008) The histone H1 family: specific members, specific functions. Biol Chem. 389 (4): 333-43.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.