Encomenda rápida

Mouse GNB1 ORF mammalian expression plasmid, C-His tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse GNB1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1023bp
Descrição de cDNA:Full length Clone DNA of Mus musculus guanine nucleotide binding protein (G protein), beta 1 with C terminal His tag.
Sinónimo de gene:Gnb-1, C77571, AA409223
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catálogo: MG51725-CH
Preço de catálogo:   (Save )
Preço:      [How to order]
 Instruções de envio
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.