Encomenda rápida

Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato GMPR Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_025508.4
    Tamanho de cDNA:1038bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
    Sinónimo de gene:AV028449, 2310004P21Rik
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GMPR qPCR primers for gene expression analysis, MP201265 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51395-ACG$225
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51395-ACR$225
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51395-ANG$225
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51395-ANR$225
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51395-CF$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51395-CH$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51395-CM$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51395-CY$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51395-NF$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51395-NH$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51395-NM$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51395-NY$195
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51395-U$75
    Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51395-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

    Size / Price
    Catálogo: MG51395-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"