Encomenda rápida

Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse GMPR Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1038bp
Descrição de cDNA:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
Sinónimo de gene:AV028449, 2310004P21Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51395-ACG$225
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51395-ACR$225
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51395-ANG$225
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51395-ANR$225
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51395-CF$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51395-CH$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51395-CM$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51395-CY$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51395-NF$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51395-NH$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51395-NM$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51395-NY$195
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51395-U$75
Ratazanao GMPR / GMPR1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51395-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Size / Price
Catálogo: MG51395-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.