After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse GLO1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_025374.3
Tamanho de cDNA:555bp
Descrição de cDNA:Full length Clone DNA of Mus musculus glyoxalase 1 with C terminal Myc tag.
Sinónimo de gene:GLY1, Qglo, Glo-1, Glo-1r, Glo-1s, Glo1-r, Glo1-s, AW550643, 0610009E22Rik, 1110008E19Rik, 2510049H23Rik, Glo1
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50364-ACG$225
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50364-ACR$225
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50364-ANG$225
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50364-ANR$225
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50364-CF$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50364-CH$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50364-CM$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50364-CY$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50364-M$75
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50364-NF$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50364-NH$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50364-NM$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50364-NY$195
Ratazanao GLO1/Glyoxalase 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50364-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Mouse Lactoylglutathione lyase, also known as Methylglyoxalase, Aldoketomutase, Glyoxalase I, Ketone-aldehyde mutase, S-D-lactoylglutathione methylglyoxal lyase and GLO1, is a member of the glyoxalase I family. GLO1 / Glyoxalase I is a ubiquitous cellular defense enzyme involved in the detoxification of methylglyoxal, a cytotoxic byproduct of glycolysis. Accumulative evidence suggests an important role of GLO1 expression in protection against methylglyoxal-dependent protein adduction and cellular damage associated with diabetes, cancer, and chronological aging. GLO1 / Glyoxalase I has been implicated in anxiety-like behavior in mice and in multiple psychiatric diseases in humans. GLO1 / Glyoxalase I catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione. GLO1 / Glyoxalase I exists in three separable isoforms which originate from two alleles in the genome. These correspond to two homodimers and one heterodimer composed of two subunits showing different electrophoretic properties. GLO1 upregulation may play a functional role in glycolytic adaptations of cancer cells.

Referências
  • Wu, YY. et al., 2008,Prog Neuropsychopharmacol Biol Psychiatry. 32 (7):1740-4.
  • Williams,R. et al., 2009, PLoS One  4 (3): e4649.
  • Antognelli,C. et al., 2009, BMC Cancer  9 :115.
  • Bair,W.B. et al., 2010, Melanoma Res  20 (2):85-96.
  • Size / Price
    Catálogo: MG50364-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"