Encomenda rápida

Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse FAM126B Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1761bp
Descrição de cDNA:Full length Clone DNA of Mus musculus family with sequence similarity 126, member B with N terminal His tag.
Sinónimo de gene:D1Ertd53e, D630010C10, C130065N10Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52548-ACG$245
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52548-ACR$245
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52548-ANG$245
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52548-ANR$245
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52548-CF$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52548-CH$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52548-CM$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52548-CY$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de expressão)MG52548-G$75
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52548-NF$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52548-NH$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52548-NM$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52548-NY$215
Ratazanao FAM126B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52548-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52548-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.