Encomenda rápida

Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse F9 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1416bp
Descrição de cDNA:Full length Clone DNA of Mus musculus coagulation factor IX with C terminal Myc tag.
Sinónimo de gene:Cf9, Cf-9, AW111646, F9
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50362-ACG$225
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50362-ACR$225
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50362-CF$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50362-CH$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50362-CM$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50362-CY$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50362-G$75
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50362-NF$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50362-NH$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50362-NM$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50362-NY$195
Ratazanao Coagulation Factor IX / FIX / F9 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50362-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Size / Price
    Catálogo: MG50362-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.