After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse F3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:885bp
Descrição de cDNA:Full length Clone DNA of Mus musculus coagulation factor III with C terminal Flag tag.
Sinónimo de gene:TF, Cf3, Cf-3, CD142, AA409063, F3
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50413-ACG$225
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50413-ACR$225
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50413-CF$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50413-CH$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50413-CM$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50413-CY$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50413-M$75
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50413-NF$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50413-NH$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50413-NM$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50413-NY$195
Ratazanao Coagulation Factor III / Tissue Factor / CD142 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50413-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.

  • Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.
  • Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.
  • Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.
  • Size / Price
    Catálogo: MG50413-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.