Encomenda rápida

Text Size:AAA

Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse F11R Informações sobre o produto de clone de cDNA
Tamanho de cDNA:903bp
Descrição de cDNA:Full length Clone DNA of Mus musculus F11 receptor with N terminal Flag tag.
Sinónimo de gene:JAM, Jcam, JAM-1, JAM-A, Jcam1, Ly106, ESTM33, AA638916, 9130004G24, F11r
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50463-ACG$225
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50463-ACR$225
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50463-CF$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50463-CH$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50463-CM$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50463-CY$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de expressão)MG50463-M$75
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50463-NF$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50463-NH$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50463-NM$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50463-NY$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50463-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catálogo: MG50463-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.