Encomenda rápida

Text Size:AAA

Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse F11R Informações sobre o produto de clone de cDNA
Tamanho de cDNA:903bp
Descrição de cDNA:Full length Clone DNA of Mus musculus F11 receptor with C terminal His tag.
Sinónimo de gene:JAM, Jcam, JAM-1, JAM-A, Jcam1, Ly106, ESTM33, AA638916, 9130004G24, F11r
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50463-ACG$225
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50463-ACR$225
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50463-CF$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50463-CH$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50463-CM$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50463-CY$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de expressão)MG50463-M$75
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50463-NF$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50463-NH$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50463-NM$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50463-NY$195
Ratazanao Junctional Adhesion Molecule A clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50463-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catálogo: MG50463-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.