After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse EPHX1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1368bp
Descrição de cDNA:Full length Clone DNA of Mus musculus epoxide hydrolase 1, microsomal with N terminal His tag.
Sinónimo de gene:mEH, Eph1, Eph-1, AI195553
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51960-ACG$225
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51960-ACR$225
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51960-ANG$225
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51960-ANR$225
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51960-CF$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51960-CH$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51960-CM$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51960-CY$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51960-G$75
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51960-NF$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51960-NH$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51960-NM$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51960-NY$195
Ratazanao Epoxide hydrolase/EPHX1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51960-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51960-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.